Strain Information | |
---|---|
Image | |
BRC No. | RBRC09937 |
Type | Transgene |
Species | Mus musculus |
Strain name | B6D2-Ddx3y<em1Osb> Tg(CAG/Su9-DsRed2,Acr3-EGFP)RBGS002Osb |
Former Common name | Ddx3y<x/+225> |
H-2 Haplotype | |
ES Cell line | |
Background strain | |
Appearance | |
Strain development | Developed by Ayako Isotani and Masahito Ikawa, Research Institute for Microbial Diseases, Osaka University in 2013. BDF1 background. |
Strain description | Dbx3y mutant mice (225 bp insertion) generated by the CRISPR/Cas9 technique. This strain also has a transgene, Tg(CAG/Su9-DsRed2,Acr3-EGFP)RBGS002Osb (RBRC03743).Ddx3y<em1Osb>: 225 bp insertion catgccctcatctcaatatcccataaggtacaacactaaaccagaatattaacaaagtacaagtcacgttttacttactgaaattttaaattgctaattattaaaagctgttgaaattttgtttgggtatccagtgtctatcactgtactgggatcagttattttagaagtctgtggcaatgaagagactttttgggttttgttctttttttccttgaaagGGGTCTGTGATAAGGACAGTTCAGGATGGAGCTGTAGTAAAGATAAAGATGCCTACAGCAGTTTTGGATCTCGTGATTCCAGAGGGAAGCCCAATTATTTCAGTGATCGTGG(ATCCACATTGGACGGTTGGAGATTGACTTTTGCTTTTGATTGTGGCTGTGCCCTGATATTTTCCCTCTCGAAGGAAGAAACTGTTTTAGTGGAGCCCACAGTTAAGAGACTTTTAATTGTAAAAAGACTTTGGATTTTAAAAGAGATGGCTATTTTAAAGAAATTGAAATTTTAAGAATATGTAAAGACTGTGGGACTTTTAAAGTTATTTAAATCTAATCCACA)AAGTGGATCCAGGGGAAGgtatattcttggttgataatgtacaaagtaatggttaagtatcttagtagttaagaatatgtaagaatcttaacttagcaaagtcagggttctcaaaactgatagaatgaatctgtctacctacttacctaagaatttactaattagagtggtgtacatgttgttgtccaactagtccaacaatggctatcc |
Colony maintenance | |
References | J. Reprod. Dev., 65(2):121-128 (2019). 30613052 |
Health Report | |
---|---|
Examination Date / Room / Rack |
Gene | |
---|---|
Gene info | Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter DsRed2Red Fluorescent Protein (Discosoma sp.)UNDsRed2CAG promoter (CMV-IE enhancer, chicken beta-actin promoter, rabbit beta-globin genomic DNA) Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter EGFPEnhanced Green Fluorescent Protein (Aequorea victoria)UNEGFPmouse proacrosin promoter Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter Su9mitochondria localization signal of mouse Atp5g1[ATP synthase Fo complex subunit 9 (su9)]UNSu9 Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter Ddx3yDEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linkedYDdx3y<em1Osb>endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University8030469F12Rik, D1Pas1-rs1, Dby |
Ordering Information | |
---|---|
Donor DNA | chicken beta-actin promoter, rabbit beta-globin polyadenylation signal, CMV CMV IE enhancer, mouse proacrosin signal peptide, mouse acrosin N-ternimal peptide, jellyfish GFP cDNA, mouse acrosin promoter, mouse Cdc20b genomic DNA, SV40 polyadenylation site, mouse PGK promoter, E.coli. Neomysin phosphotransferase gene (neoR), Yeast FRT site, Phage P1 loxP site |
Research application | Cre/loxP system FLP/frt system Fluorescent Proteins/lacZ System |
Specific Term and Conditions | The RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. J. Reprod. Dev., 65(2):121-128 (2019).RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again. |
Depositor | Masahito Ikawa (Osaka University) |
Strain Status | Frozen sperm |
Strain Availability | Recovery and QC required prior to distribution |
Additional Info. | Necessary documents for ordering:
|
BRC mice in Publications |
---|
No Data |